Wild Brettanomyces – a Needle in a Haystack

plate of wild bretanomcyes colonies
Purified yeast colonies

A few days ago I posted a rather long post about the methods and preliminary results from an experiment meant to isolate wild Brettanomyces from the rhizosphere of plants. This experiment was based on a chance finding of several papers which found Brettanomyces in this environmental niche. This was exciting as the natural environment of Brettanomyces is not known, which has precluded an understanding of how it contaminates wine and makes its way into sour beer. The experiment appeared to work well, and produced 8 strains (out of 12 isolated) that I assigned a low or medium probability of being Brettanomyces, based on morphology and growth characteristics. I have since sequenced the ITS of all 12 strains, and now have a firm identification of each.

And the experiment was successful – but less successful than I had hoped.

Other Parts to this Series:

The Wild Brettanomyces

Of the 12 isolated strains, two were wild Brettanomyces.

Yeast clone C1
Yeast clone C1

The first of these – clone C1 – was Brettanomyces nanus, one of the rarer species of Brettanomyces. It is used occasionally in brewing, though largely in an experimental context. It is in interesting species, as compared to Brettanomyces bruxellensisB. nanus seems to be evolved to survive in a tougher environment. It has evolved genes to process complex carbohydrates like starch (oligo-1,6-glucosidases), to recover bound sugars (β-glucosidases and β-galactosidase). This makes sense given that I recovered this yeast from a rhizosphere. These genes would allow B. nanus to recover sugars for fermentation or oxidation from challenging sources. It may also give this yeast good bioconversion activity in a fermentation.

Yeast clone C4
Yeast clone C4

The second clone – clone C4 – was Brettanomyces custersianus, another rare species of Brettanomyces. This one was also a surprise, as this was one of the colonies which accumulated bromocresol green – Brettanomyces are typically identified based on their ability to process this dye. None-the-less, I sequenced this one twice and got the same identification both times. As with B. nanus, this species is rarely used in brewing. B. custersianus does not have the same adaptations to acquire sugars as does B. nanus, and instead has an expanded ability to process unusual amino acids including pipecolic acid and sarcosine. These are interesting molecules which are produced by some plants, with sarcosine released by the roots of some plants to promote the growth of their rhizoshphere.

These were interesting strains to identify, and biochemically, it makes sense to find them in a rhizosphere. Unfortunately, this doesn’t really answer the question of whether the rhizosphere is where our wine and beer Brettanomyces come from. The reason for this is that the species in wine and beer are usually B. bruxellensis, are occasionally B. anomalus, and are almost never B. nanus or B. custersianus.


What Were the Other Yeasts?

You may be wondering what the other 10 species of yeast were…and sadly, they were all different species of Pichia. After discussion at Milk the Funk with some real yeast scientists, this makes a lot of sense. There are commonly found in soil, are resistant to cycloheximide, can process bromocresol green, and grow rapidly in culture. This would explain the appearance of these colonies in just two days, rather than the 7-10 more typical of Brettanomyces. Interestingly, these discussions also nicely explains the Brettanomyces cultures I recovered. B. nanus is quick growing, and thus would be able to appear on plates as quickly as Pichia, while the B. custersianus colony was very slow growing, explaining its slow growth after purification.

Pichia is commonly found in the early stages of wild fermentations, but tends to disappear after the first week as increasing alcohol concentrations and decreasing oxygen availability cause it to die. Due to my timing – especially of my sub-culture – I inadvertently enriched for Pichia. Had I stuck to my original time-frame, my likelihood of isolating more Brettanomyces would have been much higher, as I would have been performing my isolation at a timepoint where Pichia should have largely died off.


What is Next for the Wild Brettanomyces Project?

Even though I have two strains, I’m not yet done with this project. Based on my discussions at Milk the Funk, I’ve decided to to another round of sub-cultures of my initial anaerobic culture. That culture had a full 2 weeks at room temperature, and has been stored at refrigerator temperatures since. Since I performed my first sub-cultures after 1 week of growth, this should mean that there has been a further enrichment for Brettanomyces in these cultures. In addition, I’m changing the isolation medium to give Brettanomyces a further growth advantage:

  1. I am using 0.1g/mL DME in place of YPD or WLN medium. This should provide ample dextrans to allow for the prolonged growth of Brettanomyces.
  2. Ethanol has been added, to a concentration of 5%. Fermentation of the DME may increase this to 9.5%. This should suppress the growth of many bacteria and unwanted yeasts/fungi.
  3. The same antibiotics are being added, to help suppress bacteria.
  4. I am increasing the concentration of cycloheximide to 100 mg/L. This should suppress Pichia and most other yeasts, but allow Brettanomyces to grow.
  5. I will make both aerobic and anaerobic sub-cultures.

I will check these cultures weekly by microscopy. At time points where I see Brettanomyces-like cells I will plate out cultures on the same selective/differential medium as used in my last post. I’ve setup these new cultures already, and will hopefully have an additional post on the success (or failure) of this sub-culture before Christmas.

I am also performing fermentation trials with the B. nanus or B. custersianus, in both pure and mixed (with US-05) fermentations. Sadly, B. nanus seems to have stopped fermenting after just 24 hours and a meager 27% attenuation, but I will continue to allow it to grow in the hopes it gets a second wind. B. custersianus is plugging along slowly, but continues to show signs of active fermentation 4 days after pitching.


ITS Sequences

I’ve included the ITS sequences for the two Brettanomcyes strains, below, in case anyone is interested.

CloneSpeciesITS Sequence
C1B. nanusGAGCGAAGAGCGAGCGATCGCAGCGAGCGCAGCGAGGGAGCAAGCAAGTAAAAACTTGCAAGCAACCTTGCCAGCTCCGC
CATACACGTGAGTAATTACAAACAGTACCTGTCAACATACGAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCA
TCGATGAAGAGCGCAGCGAATTGCGATAACTAATGTGAATTGCAGATTTTGTGAATCATCGAGTTCTTGAACGCACATTG
GCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGCGTGACAACGCCTCCATTGGCCTCCAATGGTATTGTGGATACATA
GTATCCACCAAAAAGAAAGTACGAAGAATTAAGGTTTCGGCCAGGCTTTGTTATTTTTTTAAT
C4B. custersianusATTAACGAAGCGAACACGAGGCGTCAGCCGAGTGCAAGCATTATACACATGTTTTCATTAGCATACAAACACAACAAACC
AAAATTTATCAACACTTTATTAAAACTTTCAACAATGGATCTCTTGGTTCTCGCGTCGATGAAGAGCGCAGCGAATTGCG
ATAACTAATGTGAATTGCAGATTTTCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCA
TGCCTGTTTGAGCGTCATTTCCTTCTAACTATACAGTAGTTGTGATGACGGCACCGCGTGCGGTCCGTCGAAGAGAATGA
CAGTTAACGGAGTAAGGTTTCGACCAGTCGTTGACTTTTATCTACGATTGACCTCAAA

Other Parts to this Series:

Leave a Reply

Your email address will not be published. Required fields are marked *

Are you human? Please solve:Captcha