Using PCR to Identify Contamination in Beer – Part 2

Note to my readers: This technique does not work as well as hoped. I am, however, completing this series as I get a lot of questions about it. The effectiveness and limitations of this method are described in-detail in post #3 (link below). 
                                      -Bryan, Dec 4, 2019

This is the second post in a short series on using PCR to detect contamination in beer. The impetus for this mini-series is a lawsuit recently launched against White Labs for contamination of commercial pitches with Saccharomyces cerevesia variant diastaticus, a sub-species of conventional brewers yeast which has the ability to breakdown starches and dextrins, leading to super-attenuation and off-flavours in infected beer.

This lawsuit follows several years of contamination issues at White labs, many of which were discovered and/or documented here – including “contamination” of their Lactobacillus cultures, mis-identified a Sacch as a Brett, and have a mixed culture in place of a pure culture in their version of Brett Drai. TO my mind, it is not surprizing that these mistakes happen – any production facility producing multiple strains of yeast &/or bacteria is at a high risk of cross-contamination between cultures, with cross-contamination requiring only a small slip in their quality control procedures.

For the home brewer there isn’t much we can do but roll with the punches (i.e. dump or foist on our friends the odd batch that has contamination from the manufacturer), but for commercial breweries this can be a very serious issue – wasted product, lost production time, and a hit to their public image – all things which can cost a lot of money. In this series I am outlining a method which is capable of detecting fairly minute levels of bacterial and diastaticus contamination, in theory, as little as one contaminating cell per ten million “normal” yeasts. The cost of this is out-of-reach for most home brewers – although it is dirt cheap if you are lucky enough to work/train in a lab with PCR and gel electrophoresis equipment.

The main cost of this procedure is the purchase of equipment. A large part of this cost is driven by the fact that scientific equipment is built to be highly accurate and reproducible – which isn’t cheap. The good news is that we don’t need that level of accuracy for this type of testing, and there is a growing market for cheaper instruments orientated at hobbysts and people needing lower-fidelity instruments. In addition, there is a budding biohacker community posting plans for DIY equipment that, for the mechanically inclined, can bring these equipment costs down to pennies on the dollar compared to commercial equipment.

Below I’ve outlined the equipment needed, including links to inexpensive commercial units that have the necessary precision for what we are trying to do, and where possible, links to DIY versions. All prices are catalogue prices for new equipment – the same/similar equipment can often be found second-hand on Ebay and at used scientific equipment resellers, and if outfitting a lab from scratch, you can often get a bundle deal from the manufacturer for 30-50% off of list price.

PCR for Detecting Contamination in Beer: (links will be added as series is released)


Equipment

Thermocycler: The thermocycler (AKA ‘PCR Machine’) is the heart of this procedure, and the piece of equipment brewers are least likely to have on-hand. For a description of how PCR works, see post 1 of this series. As the name suggests, these machines continually cycle through a range of temperatures, and it is those temperature changes which drive the PCR reaction.  In general, a PCR reaction starts by heating the sample to 96-98C, which forces the DNA in the sample to become single-stranded (denaturing). The sample is then cooled to around 50C to allow the primers to anneal (bind) to the DNA, and then the reaction is heated to 72C to allow the DNA polymerase to copy the region of DNA we are trying to detect. A thermocycler can complete one of these cycles in a few minutes, allowing for 35-45 cycles to be completed in less than 3 hours.

Research-grade instruments are quite expensive and have a lot of bells-and-whistles;  e.g. the ability to control the rate of temperature change, or to have part of the PCR block (the heat-exchange surface) to be at different temperatures at the same time. Even basic units start around $2500.

In the commercial brewery this type of precision and speed is not needed – in fact, we could get away with three water baths at the correct temperature and a peon (sorry, “assistant brewer”) manually moving tubes from one water bath to the next. Believe it or not, that is how I did my first PCR, waaaay back in the bad-ol 1990’s! Of course, a thermocycler is a better option, but all that is needed is a basic model. These can be found for under $700, or can even be homebrewed for under $100 (another DIY option).

DNA Gel Apparatus: A DNA gel apparatus is required to resolve (separate by size) the DNA bands produced by the PCR reaction. Again, commercial units are typically over $800, but budget-conscious models are becoming available, some even with a build-in illuminator, saving you the cost of a separate unit! Of course, you can always DIY.

Power Supply: A power supply that can provide sufficient voltage and amperage to run the DNA gel is required. Scientific grade units start at ~$300, and can easily exceed $2K. The budget DNA gel apparatus mentioned above has a built-in power supply, and of course, you can DIY this as well.

Transilluminator: Once the DNA is run through the gel, we need to be able to see it. This is done using a transilluminator, which shines UV light through the gel; this excites a DNA-binding dye added to the gel, allowing you to see the bands (and take a picture with your phone, if needed). Commercial units are typically a few hundred bucks – I’d suggest the DNA gel apparatus linked to above that includes a built-in transilluminator, which is about the same price, or a DIY model.

Bundle Pack? I’ve not used this kit myself, but have heard good things about it. Minipcr (the company linked to extensively above) cells a bundle that has a lot of the instrumentation needed to run this test – PCR machine, DNA gel apparatus + transilluminator, all for under a grand. It also comes with a single pipettor of unknown quality. If you purchase this pack you’ll still need the equipment listed below, but it does take care of everything listed above – for under $1000!

MicroPipettors: Critical to success in this assay is the ability to accurately measure small liquid volumes across a range of 0.5ul – 1000ul (0.0005ml to 1 ml). While cheap micropipettors are readily available, these units tend not to last. I’d recommend looking for a second-hand set of Eppendorf-branded or Reiner-branded pipettors. If not, I’d recommend the educational-grade ones from Fisher. I would recommend buying a 0.5-2ul, 2-20ul and 200-1000ul pipettors; a 20-200ul unit is nice to have, but is not needed for this procedure.

Microcentrifuge: You will need a centrifuge which can generate  at least 4,000 xg. Old bench-top units can often be found second hand and work fine. There are a number of companies selling hand-sized units; some of these may work, so long as they reach 4,000 x g (about 10,000 rpm for handheld sized machines). Make sure the unit you select holds 1.5ml tubes. Cost: $200 (hand-sized) – $3,000 (entry-level benchtop unit). This is not something you want to DIY…

Vortex: You are going to need to generate significant shear forces, which requires a vortex. Again, these can be found cheap second-hand, but a new basic unit costs $250.

Water-bath: You are also going to need a reliable way to hold water at ~50C and near boiling. You could spend a lot of money on a scientific water bath, but they are seriously overpriced ($800 and up). Instead, go buy a cheap crockpot and an STC-1000 (or equivalent) temperature controller – vola, a $50 water bath that is more stable and digitally controlled, unlike the nearly $1K analog scientific models.


Consumables

Sterile distilled water: In theory you could buy distilled drinking water and then pressure-cook it to sterilise, I would not suggest this as bacteria in the water (even though dead) may create false-positives. Instead drop $30 on a litre of nuclease-free water – this is enough for ~400 tests, and will last forever so long as you keep it clean.

Pipette tips: Just buy them cheap, by the bag. There is no need to pay for expensive, sterilized and racked tips. Cost: $10-20 per bag of 500 (enough for ~200 tests).

PCR Polymerase: There are a lot of options for PCR enzymes out there…but watch out – many are for situations where high fidelity is needed. We don’t care about fidelity, so the cheapest enzyme we can find is all we need. I prefer TSG polymerase for all of my basic PCR needs. Its cheap and reliable – $22 for enough for 100 tests.

Nucleotides: For reasons I don’t understand, PCR enzymes don’t come with the nucleotides that the enzyme uses when it copies DNA…so you’ll need to buy some – $48 for enough for 250 tests.

Primers: Lots of companies sell primers. I recommend IDT, although many other good companies are out there. I bought the primers needed for this test (6 in total), cost was $4.50 to $5.20 per primer, plus a flat $15 for shipping – $45 all-in, enough for 100 tests.  I recommend buying 25 nmole at a time (minimum sized purchase) and getting them “lab ready” formulated – this means the primers are pre-dissolved at a 100x working concentration. The primers you will need are:

  • ITS1: TCCGTAGGTGAACCTGCGG
    ITS4: TCCTCCGCTTATTGATATGC
  • STA1-F: GATGGTGACGCAATCACGA
  • STA1-R: CAACTACGACTTCTGTCATA
  • pA: AGAGTTTGATCCTGGCTCAG
  • pH: AAGGAGGTGATCCAGCCGCA

Note that the pA/pH primers are for bacteria and are only required if you wish to do bacteria-specific testing.

DNA Ladder: Used to tell the size of your DNA – $46 for 100 tests.

1.5ml Centrifuge Tubes: Used for the DNA isolation. Under $10 for 500; enough for 250 tests.

PCR Tubes: Small (0.2ml) tubes used by most PCR machines. Under $15 for 1000, enough for 500 tests.

DNA Loading Dye: Used to ensure easy loading of DNA into the gel. Also contains a dye to allow you to track the movement of the DNA through the gel. $25 for 5ml – enough for ~1000 tests.

Agarose: Used to make the gel. $35 for 50g – enough for ~160 gels; each gel could be used for upto 4 tests.

TAE Buffer: Used to make the gel and used to fill the gel running tray. $40 for enough pre-mix to make 25L; enough for ~80 gels.

Ethidium bromide: Dye used to visualise the DNA in your gel. $12 for a gram; enough for ~100 gels.


Cost Breakdown

The cost of equipment is going to be highly variable, but if buying a mix of used and budget equipment, $3k to $5K should get you going.

The cost of individual tests also can vary, depending on whether you maximise the use of your DNA gel by loading multiple tests onto a single gel. If you run 1 gel per test, your per-test cost is $2.39. If you run a full gel (4 tests/gel) your per-test cost drops to $1.76.

If you amortise your equipment costs over 200 tests, your cost-per-test will be $34 to $37 if your equipment costs are on the high-end; on-par with commercial kits. If your equipment costs are on the lower end, the cost per test is $24-$26. Both of those are cheaper than commercial kits when the cost of equipment/consumables not included in the kits are taken into account. A medium-sized brewery could easily recoup their costs in 1 or 2 years, and the all-in cost to get equipment plus reagents for 100 tests is easily less than the value of a single infected batch of beer.

Of course, if you have friends with access to this equipment – say at a local university, college or biotech company – your costs drop to consumables plus whatever fee you agree upon for use of the equipment…

…for the record, I take payment in beer or Scotch whiskey.

4 thoughts on “Using PCR to Identify Contamination in Beer – Part 2

  • November 13, 2019 at 9:34 PM
    Permalink

    Thanks for the information. Will part 3 be available in the near future?

    Reply
    • November 14, 2019 at 12:50 AM
      Permalink

      Unfortunately, no. As it turns out, while the method works the concept is fatally flawed. While this technique accurately detects the presence of the Sta1 gene (the diastatius gene), it turns out that simply detecting the presence of the gene is not enough. There are many strains that have the Sta1 gene which are not diastatic – i.e. they don’t super-attenuate the wort. We do not yet know why this is, but some of the yeasts which have the gene simply don’t use it. Because of that limitation I didn’t bother finishing the series, as it is not actually a useful test for brewers.

      Reply

Leave a Reply

Your email address will not be published. Required fields are marked *

Are you human? Please solve:Captcha